Top » Catalog » SNPs » rs1015362

$18.00

rs1015362
[rs1015362]

rs1015362
hg38 Position: Chr20:34150806..34150806
Ancestral: A
Derived: G
Reference:
ISOGG Haplogroup: none
Comments: .
Forward Primer: rs1015362_F ATGGGGGTTCTAATGGCTTC
Reverse Primer: rs1015362_R TACACATGCTGCTCCCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies