Top » Catalog » SNPs » rs11803731

$18.00

rs11803731
[rs11803731]

rs11803731
hg38 Position: Chr1:152110849..152110849
Ancestral: A
Derived: T
Reference: dbSNP
ISOGG Haplogroup: none
Comments: TCHH gene. T means curly hair
Forward Primer: rs11803731_F AGTTGCCACCTCCATTTTTG
Reverse Primer: rs11803731_R GCCAAGAGCAGGAGGAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies