Top » Catalog » SNPs » rs17646946

$18.00

rs17646946
[rs17646946]

rs17646946
hg38 Position: Chr1:152090291..152090291
Ancestral: A
Derived: G
Reference: dbSNP
ISOGG Haplogroup: none
Comments: TCHHL1
Forward Primer: rs17646946_F TCGAGGAACATACAAGGGAAC
Reverse Primer: rs17646946_R GCCCATGTAAAGCTCCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies