Top » Catalog » SNPs » rs7349332

$18.00

rs7349332
[rs7349332]

rs7349332
hg38 Position: Chr2:218891661..218891661
Ancestral: C
Derived: T
Reference: dbSNP
ISOGG Haplogroup: none
Comments: WNT10A
Forward Primer: rs7349332_F TAGAGGCGGGGTAAACTGAG
Reverse Primer: rs7349332_R TTCACCAGAAACCCCGTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies