Top » Catalog » SNPs » A315

$18.00

A315
[A315]

A315
hg38 Position: ChrY:20926625..20926625
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1 (not listed)
Comments: .
Forward Primer: A315_F GCTTCCCTTAGGGCTTTGAG
Reverse Primer: A315_R GCTGCCCCTACCTTTCTCTG
Reviews

Customers who bought this product also purchased
A312
A312
A311
A311
A310
A310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies