Top » Catalog » SNPs » A356

$18.00

A356
[A356]

A356
hg38 Position: ChrY:15447088..15447088
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a3
Comments: Downstream CTS5966 (Dinaric-South)
Forward Primer: A356_F TTGTCATCAACCTGCCAGAC
Reverse Primer: A356_R AGGCGACTGGTCAGATCTTC
Reviews

Customers who bought this product also purchased
PH3314
PH3314
FT177529
FT177529
Y30726
Y30726
S10860
S10860
FT14649
FT14649
Z2582
Z2582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies