Top » Catalog » SNPs » A356

$18.00

A356
[A356]

A356
hg38 Position: ChrY:15447088..15447088
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a3
Comments: Downstream CTS5966 (Dinaric-South)
Forward Primer: A356_F TTGTCATCAACCTGCCAGAC
Reverse Primer: A356_R AGGCGACTGGTCAGATCTTC
Reviews

Customers who bought this product also purchased
FT34788
FT34788
PF4609
PF4609
L145
L145
L181
L181
mtComplete
mtComplete
M284
M284
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies