Top » Catalog » SNPs » A356

$18.00

A356
[A356]

A356
hg38 Position: ChrY:15447088..15447088
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a3
Comments: Downstream CTS5966 (Dinaric-South)
Forward Primer: A356_F TTGTCATCAACCTGCCAGAC
Reverse Primer: A356_R AGGCGACTGGTCAGATCTTC
Reviews

Customers who bought this product also purchased
A13911
A13911
BY106777
BY106777
Y6658
Y6658
A22782
A22782
A8740
A8740
FT14506
FT14506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies