Top » Catalog » SNPs » FT49932

$18.00

FT49932
[FT49932]

FT49932
hg38 Position: ChrY:9243472..9243472
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT49932_F CCCCACAGATGCAACCG
Reverse Primer: FT49932_R TGATAAATATGCCCAATAAGTATAATTGC
Reviews

Customers who bought this product also purchased
Y33200
Y33200
FT51313
FT51313
Y32147
Y32147
BY63033
BY63033
A1777
A1777
A24000
A24000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies