Top » Catalog » SNPs » FT49932

$18.00

FT49932
[FT49932]

FT49932
hg38 Position: ChrY:9243472..9243472
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT49932_F CCCCACAGATGCAACCG
Reverse Primer: FT49932_R TGATAAATATGCCCAATAAGTATAATTGC
Reviews

Customers who bought this product also purchased
A1777
A1777
A24000
A24000
CTS9219
CTS9219
BY105603
BY105603
R1b-Z2103 Panel
R1b-Z2103 Panel
FT63546
FT63546
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies