Top » Catalog » SNPs » FT50930

$18.00

FT50930
[FT50930]

FT50930
hg38 Position: ChrY:16111850..16111850
Ancestral: T
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT50930_F AGGTAGTAAAGAATACAGAATTCAGTTTGC
Reverse Primer: FT50930_R CCTTGGGGTAGGCTGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies