Top » Catalog » SNPs » FT50932

$18.00

FT50932
[FT50932]

FT50932
hg38 Position: ChrY:16114291..16114291
Ancestral: G
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT50932_F ATATGGATTTGTTCCTTAATCAATTACC
Reverse Primer: FT50932_R CCTGCACATTGTACACATGTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies