Top » Catalog » SNPs » FT62850

$18.00

FT62850
[FT62850]

FT62850
hg38 Position: ChrY:8257928..8257928
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT62850_F TAGAAGCAGCGTCCTGCTG
Reverse Primer: FT62850_R ATTCAGAATAATTTCTACCAGATCTACAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies