Top » Catalog » SNPs » Y32149

$18.00

Y32149
[Y32149]

Y32149
hg38 Position: ChrY:20724860..20724860
Ancestral: C
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y32149_F AACAATTTGGTAGACACAACACTTAAG
Reverse Primer: Y32149_R CCAAGTAACCAATAGAATACTCTAGGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies