Top » Catalog » SNPs » Y32150

$18.00

Y32150
[Y32150]

Y32150
hg38 Position: ChrY:20880902..20880902
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y32150_F AAACTGAACAGGTCATCAGAGATG
Reverse Primer: Y32150_R ACTTCTTACATGGTGGCAGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies