Top » Catalog » SNPs » Y33201

$18.00

Y33201
[Y33201]

Y33201
hg38 Position: ChrY:15087572..15087572
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y33201_F GACAGTGTTTGTATAGCTTTTAATGTAGG
Reverse Primer: Y33201_R GGTGGGAATTGAACAATGAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies