Top » Catalog » SNPs » S5739

$18.00

S5739
[S5739]

S5739
hg38 Position: ChrY:13476086..13476086
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1
Comments: under R1b-L257/S186
Forward Primer: S5739_F AGCCAAGCATGGTGGTGG
Reverse Primer: S5739_R GGAACAGTTTGGATGTTGTCTTC
Reviews

Customers who bought this product also purchased
A14483
A14483
A14489
A14489
R1b-U106 Carnegie Panel
R1b-U106 Carnegie Panel
A14487
A14487
A14486
A14486
A14485
A14485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies