Top » Catalog » SNPs » S5739

$18.00

S5739
[S5739]

S5739
hg38 Position: ChrY:13476086..13476086
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1
Comments: under R1b-L257/S186
Forward Primer: S5739_F AGCCAAGCATGGTGGTGG
Reverse Primer: S5739_R GGAACAGTTTGGATGTTGTCTTC
Reviews

Customers who bought this product also purchased
A14487
A14487
A14486
A14486
A14485
A14485
A14484
A14484
A14483
A14483
A14489
A14489
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies