Top » Catalog » SNPs » DF17

$18.00

DF17
[DF17]

DF17
hg38 Position: ChrY:6763705..6763705
Ancestral: T
Derived: G
Reference: Magoon Greg (2011)
ISOGG Haplogroup: R1b1a1a2a1a2a1a2
Comments: Based on 1000 Genomes Project data under Z195/Z196
Forward Primer: trA_DF17v3_F CTTCAGTGAGGTTGGCTTCC
Reverse Primer: trP1_DF17v3_R CCCCTCAAAGTGTAAATCTGC
Reviews (1)

Customers who bought this product also purchased
FGC28375
FGC28375
HVR1
HVR1
Z278
Z278
Z214
Z214
CTS8087
CTS8087
Z697
Z697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies