Top » Catalog » SNPs » A321

$19.00

A321
[A321]

A321
hg38 Position: ChrY:6788731..6788731
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4b2a2b1
Comments: .
Forward Primer: A321_F GAGAATGAGGGCTGCTTTTG
Reverse Primer: A321_R GAATAGTGCATTGTAAAGAGGAAGATC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A9030
A9030
Z346
Z346
FGC12993
FGC12993
Z8
Z8
S5245
S5245
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies