Top » Catalog » SNPs » FGC1389

$18.00

FGC1389
[FGC1389]

FGC1389
hg38 Position: ChrY:12062859..12062859
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC1389_F TTGAACACAGTGGGGAGAATG
Reverse Primer: FGC1389_R CTGTTAATAAGCCTCAAGTCCG
Reviews

Customers who bought this product also purchased
Z1370.2
Z1370.2
A323
A323
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies