Top » Catalog » SNPs » A376

$18.00

A376
[A376]

A376
hg38 Position: ChrY:19411901..19411901
Ancestral: G
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1~
Comments: Downstream L338+ AS1H
Forward Primer: A376_F GAGAGACACACCAGCACAGC
Reverse Primer: A376_R GTCATCAGTTAAGTCAGGGCAAG
Reviews

Customers who bought this product also purchased
YSC0000261
YSC0000261
FGC74328
FGC74328
FGC74330
FGC74330
Y12990
Y12990
Y23905
Y23905
Y7521
Y7521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies