Top » Catalog » SNPs » FGC8383

$18.00

FGC8383
[FGC8383]

FGC8383
hg38 Position: ChrY:8016363..8016363
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2 (not listed)
Comments: Approx. DF96
Forward Primer: FGC8383v2_F GGTCCCAAGTAGAAAAGCCATAG
Reverse Primer: FGC8383v2_R GATGAATGAGAGCAACTATCCTACC
Reviews

Customers who bought this product also purchased
FGC8410
FGC8410
FGC23212
FGC23212
A14207
A14207
Z301
Z301
L48
L48
BY128969
BY128969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies