Top » Catalog » SNPs » L1335

$18.00

L1335
[L1335]

L1335
hg38 Position: ChrY:20992315..20992315
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1k
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L1335_F CTACTCTAAAAGTGTCCAGTATTCAAGC
Reverse Primer: L1335_R TGGGTAGGCATGTCACTGG
Reviews

Customers who bought this product also purchased
A18726
A18726
FGC32795
FGC32795
ZS8379
ZS8379
A10642
A10642
FGC23742
FGC23742
A2501
A2501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies