Top » Catalog » SNPs » L1335

$18.00

L1335
[L1335]

L1335
hg38 Position: ChrY:20992315..20992315
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1k
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L1335_F CTACTCTAAAAGTGTCCAGTATTCAAGC
Reverse Primer: L1335_R TGGGTAGGCATGTCACTGG
Reviews

Customers who bought this product also purchased
FGC42169
FGC42169
FGC30631
FGC30631
BY11922
BY11922
FGC19534
FGC19534
L555
L555
A2201
A2201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies