Top » Catalog » SNPs » L1335

$18.00

L1335
[L1335]

L1335
hg38 Position: ChrY:20992315..20992315
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1k
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L1335_F CTACTCTAAAAGTGTCCAGTATTCAAGC
Reverse Primer: L1335_R TGGGTAGGCATGTCACTGG
Reviews

Customers who bought this product also purchased
Z18021
Z18021
BY23955
BY23955
S775
S775
BY114
BY114
BY23827
BY23827
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies