Top » Catalog » SNPs » L1335

$18.00

L1335
[L1335]

L1335
hg38 Position: ChrY:20992315..20992315
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1k
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L1335_F CTACTCTAAAAGTGTCCAGTATTCAAGC
Reverse Primer: L1335_R TGGGTAGGCATGTCACTGG
Reviews

Customers who bought this product also purchased
Y18513
Y18513
BY3927
BY3927
A7907
A7907
BY54624
BY54624
A5846
A5846
BY20463
BY20463
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies