Top » Catalog » SNPs » S1972

$18.00

S1972
[S1972]

S1972
hg38 Position: ChrY:12080275..12080275
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H
Forward Primer: S1972_F GCACCCATAATTCCCAACTC
Reverse Primer: S1972_R TTTTTGTCCACATATTCGTCATC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A9538
A9538
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies