Top » Catalog » SNPs » A368

$18.00

A368
[A368]

A368
hg38 Position: ChrY:14275263..14275263
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a2b (not listed)
Comments: Below L23 > Z2103
Forward Primer: A368_F GTGTCTACTCAAATTCATAGTGATGG
Reverse Primer: A368_R CTCAGTGGGCTCCAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies