Top » Catalog » SNPs » BY134269

$18.00

BY134269
[BY134269]

BY134269
hg38 Position: ChrY:19459454..19459454
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: G
Comments: Below L30 > L14 > ZS9461
Forward Primer: BY134269_F CAAAACATTGGATTCCCCTC
Reverse Primer: BY134269_R TTGGTGATTAGCCGTTGATTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY69595
BY69595
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies