Top » Catalog » SNPs » FT294363

$18.00

FT294363
[FT294363]

FT294363
hg38 Position: ChrY:10872759..10872759
Ancestral: A
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT294363_F CACTCCACACCACTCCATG
Reverse Primer: FT294363_R GATTGTTTGGAGTGGAGTGTAAAC
Reviews

Customers who bought this product also purchased
FT344373
FT344373
Y198676
Y198676
ZS7432
ZS7432
BY183277
BY183277
ZS7428
ZS7428
J1-L860 Panel
J1-L860 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies