Top » Catalog » SNPs » FT294363

$18.00

FT294363
[FT294363]

FT294363
hg38 Position: ChrY:10872759..10872759
Ancestral: A
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT294363_F CACTCCACACCACTCCATG
Reverse Primer: FT294363_R GATTGTTTGGAGTGGAGTGTAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies