Top » Catalog » SNPs » FGC4340

$18.00

FGC4340
[FGC4340]

FGC4340
HG19 Position: ChrY:8141763..8141763
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y8960
Forward Primer: FGC4340_F CTCCTAAAATGAACACGTCTTTCC
Reverse Primer: FGC4340_R AATCACTAATGTGACTAATCACTGTGAG
Reviews

Customers who bought this product also purchased
FGC4338
FGC4338
FGC4348
FGC4348
FGC4346
FGC4346
FGC4345
FGC4345
FGC4341
FGC4341
FGC4356
FGC4356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies