Top » Catalog » SNPs » FGC4340

$18.00

FGC4340
[FGC4340]

FGC4340
hg38 Position: ChrY:8273722..8273722
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Aka Y8960. Below FGC6 > FGC4336
Forward Primer: FGC4340_F CTCCTAAAATGAACACGTCTTTCC
Reverse Primer: FGC4340_R AATCACTAATGTGACTAATCACTGTGAG
Reviews

Customers who bought this product also purchased
FGC4356
FGC4356
FGC4339
FGC4339
FGC4351
FGC4351
FGC4338
FGC4338
FGC4348
FGC4348
FGC4346
FGC4346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies