Top » Catalog » SNPs » FGC2212

$18.00

FGC2212
[FGC2212]

FGC2212
hg38 Position: ChrY:8676918..8676918
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2212_F CTAGTGGATCCCACAGAAAAGAG
Reverse Primer: FGC2212_R CACGAAGATGGCTGGAAGC
Reviews

Customers who bought this product also purchased
FGC7722
FGC7722
FGC2213
FGC2213
FGC2222
FGC2222
FGC2262
FGC2262
CTS6667
CTS6667
FGC2221
FGC2221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies