Top » Catalog » SNPs » FGC2212

$18.00

FGC2212
[FGC2212]

FGC2212
hg38 Position: ChrY:8676918..8676918
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2212_F CTAGTGGATCCCACAGAAAAGAG
Reverse Primer: FGC2212_R CACGAAGATGGCTGGAAGC
Reviews

Customers who bought this product also purchased
FGC2218
FGC2218
FGC2226
FGC2226
V12
V12
YFS050347
YFS050347
FGC2217
FGC2217
FGC2225
FGC2225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies