Top » Catalog » SNPs » FGC2213

$18.00

FGC2213
[FGC2213]

FGC2213
hg38 Position: ChrY:8696242..8696242
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V12 > CTS693 > CTS6667 > Y2873 > CTS8411
Forward Primer: FGC2213_F CACACGCAGAAATCCAACAC
Reverse Primer: FGC2213_R AATGTCCTTGTTGCCCAGAG
Reviews

Customers who bought this product also purchased
FGC2222
FGC2222
FGC2262
FGC2262
CTS6667
CTS6667
FGC2221
FGC2221
FGC2230
FGC2230
CTS693
CTS693
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies