Top » Catalog » SNPs » FGC2213

$18.00

FGC2213
[FGC2213]

FGC2213
hg38 Position: ChrY:8696242..8696242
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V12 > CTS693 > CTS6667 > Y2873 > CTS8411
Forward Primer: FGC2213_F CACACGCAGAAATCCAACAC
Reverse Primer: FGC2213_R AATGTCCTTGTTGCCCAGAG
Reviews

Customers who bought this product also purchased
FGC2226
FGC2226
V12
V12
YFS050347
YFS050347
FGC2217
FGC2217
FGC2225
FGC2225
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies