Top » Catalog » SNPs » FGC2214

$18.00

FGC2214
[FGC2214]

FGC2214
hg38 Position: ChrY:8960760..8960760
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2214_F CCAGTGGCACGTGTCTATTTTC
Reverse Primer: FGC2214_R GTACCTCACTGATGGCGATG
Reviews

Customers who bought this product also purchased
FGC2213
FGC2213
FGC2223
FGC2223
FGC7722
FGC7722
FGC2212
FGC2212
FGC2222
FGC2222
FGC2262
FGC2262
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies