Top » Catalog » SNPs » FGC2214

$18.00

FGC2214
[FGC2214]

FGC2214
hg38 Position: ChrY:8960760..8960760
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2214_F CCAGTGGCACGTGTCTATTTTC
Reverse Primer: FGC2214_R GTACCTCACTGATGGCGATG
Reviews

Customers who bought this product also purchased
FGC2217
FGC2217
FGC2225
FGC2225
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
FGC7723
FGC7723
FGC2213
FGC2213
FGC2223
FGC2223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies