Top » Catalog » SNPs » FGC12352

$18.00

FGC12352
[FGC12352]

FGC12352
hg38 Position: ChrY:3039524..3039524
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC12352_F TGCATGCCTGCATCAAAC
Reverse Primer: FGC12352_R GGGCTAACATGTCTCTGGATG
Reviews

Customers who bought this product also purchased
FGC12363
FGC12363
S24868
S24868
FGC12367
FGC12367
FGC12354
FGC12354
A8617
A8617
A8614
A8614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies