Top » Catalog » SNPs » FGC12352

$18.00

FGC12352
[FGC12352]

FGC12352
hg38 Position: ChrY:3039524..3039524
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC12352_F TGCATGCCTGCATCAAAC
Reverse Primer: FGC12352_R GGGCTAACATGTCTCTGGATG
Reviews

Customers who bought this product also purchased
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10582
S10582
FGC12360
FGC12360
S18249
S18249
A8615
A8615
S16265
S16265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies