Top » Catalog » SNPs » FGC2217

$18.00

FGC2217
[FGC2217]

FGC2217
hg38 Position: ChrY:12063231..12063231
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b (not listed)
Comments: Aka FG1118. below V12
Forward Primer: FGC2217_F ATGGACACAAGGGGAGTTTG
Reverse Primer: FGC2217_R TGCTGCCCTGACCCTATTC
Reviews

Customers who bought this product also purchased
V12
V12
YFS050347
YFS050347
FGC2214
FGC2214
FGC2225
FGC2225
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
FGC7723
FGC7723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies