Top » Catalog » SNPs » FGC2221

$18.00

FGC2221
[FGC2221]

FGC2221
hg38 Position: ChrY:14918642..14918642
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2221_F TGCGGTTGGGAAATTTTATTAG
Reverse Primer: FGC2221_R GTGGAAGCATGCACCTATAGTC
Reviews

Customers who bought this product also purchased
FGC2225
FGC2225
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
FGC7723
FGC7723
FGC2213
FGC2213
FGC2223
FGC2223
FGC7722
FGC7722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies