Top » Catalog » SNPs » FGC2223

$18.00

FGC2223
[FGC2223]

FGC2223
hg38 Position: ChrY:16846119..16846119
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2223_F ACCAAACAATGTACCCTGAACC
Reverse Primer: FGC2223_R AACGGTATGCAAATTCCTTGAG
Reviews

Customers who bought this product also purchased
FGC2222
FGC2222
FGC7722
FGC7722
FGC2212
FGC2212
FGC2221
FGC2221
FGC2262
FGC2262
CTS6667
CTS6667
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies