Top » Catalog » SNPs » FGC2223

$18.00

FGC2223
[FGC2223]

FGC2223
hg38 Position: ChrY:16846119..16846119
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below V12
Forward Primer: FGC2223_F ACCAAACAATGTACCCTGAACC
Reverse Primer: FGC2223_R AACGGTATGCAAATTCCTTGAG
Reviews

Customers who bought this product also purchased
FGC2226
FGC2226
V12
V12
YFS050347
YFS050347
FGC2214
FGC2214
FGC2225
FGC2225
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies