Top » Catalog » SNPs » FGC2225

$19.00

FGC2225
[FGC2225]

FGC2225
hg38 Position: ChrY:17350839..17350839
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: E1b (not listed)
Comments: Aka FG1126. below V12
Forward Primer: FGC2225_F GACATGAGCTGGTGCTTGTG
Reverse Primer: FGC2225_R GAGGCATTACTAAACCTGGCAG
Reviews

Customers who bought this product also purchased
FGC2218
FGC2218
FGC2230
FGC2230
CTS693
CTS693
Y6728
Y6728
FGC2217
FGC2217
FGC2226
FGC2226
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies