Top » Catalog » SNPs » YFS050347

$18.00

YFS050347
[YFS050347]

YFS050347
hg38 Position: ChrY:19004544..19004544
Ancestral: A
Derived: C
Reference: Yfull
ISOGG Haplogroup: E1b (not listed)
Comments: Below V12
Forward Primer: YFS050347_F TGAGGAGGGGAAAGAATTGAG
Reverse Primer: YFS050347_R CCCAGCCTGTGTGTTTTCTC
Reviews

Customers who bought this product also purchased
FGC2225
FGC2225
FGC7723
FGC7723
V12
V12
FGC2214
FGC2214
FGC2223
FGC2223
E1b-V12_CTS693 Panel
E1b-V12_CTS693 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY183734
1 x A1351
1 x BY68917
1 x BY171159
1 x A6172
1 x YP1478
1 x A15352
1 x YP4497
$144.00
Haplogroup Info
Other products
Currencies