Top » Catalog » SNPs » CTS9976

$18.00

CTS9976
[CTS9976]

CTS9976
hg38 Position: ChrY:17069092..17069092
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1c
Comments: Below VL29
Forward Primer: CTS9976_F TGGCCCATCTTATATCTTCCTC
Reverse Primer: CTS9976_R CTGAATTTGGGGTAGGTTGC
Reviews

Customers who bought this product also purchased
N1a-Z1936 Panel
N1a-Z1936 Panel
Y13850
Y13850
Z1930
Z1930
Z1934
Z1934
L1032
L1032
CTS4329
CTS4329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies