Top » Catalog » SNPs » CTS9976

$18.00

CTS9976
[CTS9976]

CTS9976
hg38 Position: ChrY:17069092..17069092
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1c
Comments: Below VL29
Forward Primer: CTS9976_F TGGCCCATCTTATATCTTCCTC
Reverse Primer: CTS9976_R CTGAATTTGGGGTAGGTTGC
Reviews

Customers who bought this product also purchased
A16650
A16650
Z4945
Z4945
L1026
L1026
BY33087
BY33087
Z1936
Z1936
L395
L395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies