Top » Catalog » SNPs » CTS9976

$18.00

CTS9976
[CTS9976]

CTS9976
hg38 Position: ChrY:17069092..17069092
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1c
Comments: Below VL29
Forward Primer: CTS9976_F TGGCCCATCTTATATCTTCCTC
Reverse Primer: CTS9976_R CTGAATTTGGGGTAGGTTGC
Reviews

Customers who bought this product also purchased
Z1930
Z1930
Z1934
Z1934
L1032
L1032
CTS4329
CTS4329
Y28538
Y28538
VL62
VL62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies