Top » Catalog » SNPs » L1025

$18.00

L1025
[L1025]

L1025
hg38 Position: ChrY:12005300..12005300
Ancestral: G
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: N1c1a1a1a1
Comments: Below VL29 > L550
Forward Primer: L1025_F TCAATCCATTACAATTGTATTCCAC
Reverse Primer: L1025_R CCCTCAAAGATGTGTCTATGTCC
Reviews

Customers who bought this product also purchased
BY134916
BY134916
FGC52474
FGC52474
A11932
A11932
Y140872
Y140872
BY41225
BY41225
BY103498
BY103498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies