Top » Catalog » SNPs » Y15615

$18.00

Y15615
[Y15615]

Y15615
hg38 Position: ChrY:18983096..18983096
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > Y5004 > Y7302 > Y15814 > Y15812
Forward Primer: Y15615_F GGAGGAGAATACTGCTTCTTCCT
Reverse Primer: Y15615_R GATCTCAGATTCCTTGTTTCCAG
Reviews

Customers who bought this product also purchased
Y5005
Y5005
Y5004
Y5004
CTS9976
CTS9976
L550
L550
Y15812
Y15812
N1a-VL29 Panel
N1a-VL29 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies